microcomputer with digitized image analyzer software axio vision 4.8 (Carl Zeiss)
Carl Zeiss is a verified supplier 
Carl Zeiss manufactures this product 
90
Structured Review
Carl Zeiss
microcomputer with digitized image analyzer software axio vision 4.8
Microcomputer With Digitized Image Analyzer Software Axio Vision 4.8, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/axio-vision+imaging+software/1450+electron+leo+microscope+scanning/pm40323334-58-38-41
Average 90 stars, based on 1 article reviews
Microcomputer With Digitized Image Analyzer Software Axio Vision 4.8, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/axio-vision+imaging+software/1450+electron+leo+microscope+scanning/pm40323334-58-38-41
Average 90 stars, based on 1 article reviews
microcomputer with digitized image analyzer software axio vision 4.8 - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Recombinant:Article Title: Live imaging reveals hub cell assembly and compaction dynamics during morphogenesis of the Drosophila testis niche Article Snippet: Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: A threshold grey level for immunopositive cells was chosen that was approximately 50% of the maximum grey level cell signal over background. Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: Article Title: An actomyosin network organizes niche morphology and responds to feedback from recruited stem cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER His2Av::mRFP1 Bloomington Drosophila Stock Center Flybase: FBtp0056035; RRID: BDSC_23651; RRID: BDSC_23650 UAS-MyoII HC RNAi Bloomington Drosophia Stock Center RRID: BDSC_65947 UAS-MyoII RLC RNAi Bloomington Drosophia Stock Center RRID: BDSC_33892 UAS-Cdc25 RNAi Bloomington Drosophia Stock Center RRID: BDSC_34831 P(UAS-hid.Z)2 Bloomington Drosophia Stock Center RRID: BDSC_65403 P{w[BmC]=Dfd-EYFP.w[BmC]}2 Bloomington Drosophia Stock Center RRID: BDSC_8623 TM6B, P{Dfd-GMR-nvYFP}4, Sb[1] Tb[1] ca[1] Bloomington Drosophia Stock Center RRID: BDSC_23232 UAS-E-Cadherin RNAi (Shg RNAi) Bloomington Drosophila Stock Center RRID: BDSC_32904 Oligonucleotides Lower strand, Forward CACCCAGCAAAGACCGTGAGTTG Clark et al.63 N/A Upper strand, Reverse GTTGGATCCATTGCCATCCAGTTG Clark et al.63 N/A Recombinant DNA pENTR/D-Topo entry vector Invitrogen K240020 pBPGAL4.2::VP16Uw Addgene64 RRID: Addgene_26228 Software and algorithms Imaris https://imaris.oxinst.com/products/ imaris-for-core-facilities Imaris for Core Facilities; Oxford Instruments Article Title: A JUN N-terminal kinase inhibitor induces ectodomain shedding of the cancer-associated membrane protease Prss14/epithin via protein kinase CβII Article Snippet: Cells were observed with a Plasmid Preparation:Article Title: Live imaging reveals hub cell assembly and compaction dynamics during morphogenesis of the Drosophila testis niche Article Snippet: Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: A threshold grey level for immunopositive cells was chosen that was approximately 50% of the maximum grey level cell signal over background. Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: Article Title: An actomyosin network organizes niche morphology and responds to feedback from recruited stem cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER His2Av::mRFP1 Bloomington Drosophila Stock Center Flybase: FBtp0056035; RRID: BDSC_23651; RRID: BDSC_23650 UAS-MyoII HC RNAi Bloomington Drosophia Stock Center RRID: BDSC_65947 UAS-MyoII RLC RNAi Bloomington Drosophia Stock Center RRID: BDSC_33892 UAS-Cdc25 RNAi Bloomington Drosophia Stock Center RRID: BDSC_34831 P(UAS-hid.Z)2 Bloomington Drosophia Stock Center RRID: BDSC_65403 P{w[BmC]=Dfd-EYFP.w[BmC]}2 Bloomington Drosophia Stock Center RRID: BDSC_8623 TM6B, P{Dfd-GMR-nvYFP}4, Sb[1] Tb[1] ca[1] Bloomington Drosophia Stock Center RRID: BDSC_23232 UAS-E-Cadherin RNAi (Shg RNAi) Bloomington Drosophila Stock Center RRID: BDSC_32904 Oligonucleotides Lower strand, Forward CACCCAGCAAAGACCGTGAGTTG Clark et al.63 N/A Upper strand, Reverse GTTGGATCCATTGCCATCCAGTTG Clark et al.63 N/A Recombinant DNA pENTR/D-Topo entry vector Invitrogen K240020 pBPGAL4.2::VP16Uw Addgene64 RRID: Addgene_26228 Software and algorithms Imaris https://imaris.oxinst.com/products/ imaris-for-core-facilities Imaris for Core Facilities; Oxford Instruments Article Title: A JUN N-terminal kinase inhibitor induces ectodomain shedding of the cancer-associated membrane protease Prss14/epithin via protein kinase CβII Article Snippet: Cells were observed with a Microscopy:Article Title: Live imaging reveals hub cell assembly and compaction dynamics during morphogenesis of the Drosophila testis niche Article Snippet: Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: A threshold grey level for immunopositive cells was chosen that was approximately 50% of the maximum grey level cell signal over background. Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: Article Title: An actomyosin network organizes niche morphology and responds to feedback from recruited stem cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER His2Av::mRFP1 Bloomington Drosophila Stock Center Flybase: FBtp0056035; RRID: BDSC_23651; RRID: BDSC_23650 UAS-MyoII HC RNAi Bloomington Drosophia Stock Center RRID: BDSC_65947 UAS-MyoII RLC RNAi Bloomington Drosophia Stock Center RRID: BDSC_33892 UAS-Cdc25 RNAi Bloomington Drosophia Stock Center RRID: BDSC_34831 P(UAS-hid.Z)2 Bloomington Drosophia Stock Center RRID: BDSC_65403 P{w[BmC]=Dfd-EYFP.w[BmC]}2 Bloomington Drosophia Stock Center RRID: BDSC_8623 TM6B, P{Dfd-GMR-nvYFP}4, Sb[1] Tb[1] ca[1] Bloomington Drosophia Stock Center RRID: BDSC_23232 UAS-E-Cadherin RNAi (Shg RNAi) Bloomington Drosophila Stock Center RRID: BDSC_32904 Oligonucleotides Lower strand, Forward CACCCAGCAAAGACCGTGAGTTG Clark et al.63 N/A Upper strand, Reverse GTTGGATCCATTGCCATCCAGTTG Clark et al.63 N/A Recombinant DNA pENTR/D-Topo entry vector Invitrogen K240020 pBPGAL4.2::VP16Uw Addgene64 RRID: Addgene_26228 Software and algorithms Imaris https://imaris.oxinst.com/products/ imaris-for-core-facilities Imaris for Core Facilities; Oxford Instruments Article Title: A JUN N-terminal kinase inhibitor induces ectodomain shedding of the cancer-associated membrane protease Prss14/epithin via protein kinase CβII Article Snippet: Cells were observed with a Software:Article Title: Live imaging reveals hub cell assembly and compaction dynamics during morphogenesis of the Drosophila testis niche Article Snippet: Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: A threshold grey level for immunopositive cells was chosen that was approximately 50% of the maximum grey level cell signal over background. Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: Article Title: An actomyosin network organizes niche morphology and responds to feedback from recruited stem cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER His2Av::mRFP1 Bloomington Drosophila Stock Center Flybase: FBtp0056035; RRID: BDSC_23651; RRID: BDSC_23650 UAS-MyoII HC RNAi Bloomington Drosophia Stock Center RRID: BDSC_65947 UAS-MyoII RLC RNAi Bloomington Drosophia Stock Center RRID: BDSC_33892 UAS-Cdc25 RNAi Bloomington Drosophia Stock Center RRID: BDSC_34831 P(UAS-hid.Z)2 Bloomington Drosophia Stock Center RRID: BDSC_65403 P{w[BmC]=Dfd-EYFP.w[BmC]}2 Bloomington Drosophia Stock Center RRID: BDSC_8623 TM6B, P{Dfd-GMR-nvYFP}4, Sb[1] Tb[1] ca[1] Bloomington Drosophia Stock Center RRID: BDSC_23232 UAS-E-Cadherin RNAi (Shg RNAi) Bloomington Drosophila Stock Center RRID: BDSC_32904 Oligonucleotides Lower strand, Forward CACCCAGCAAAGACCGTGAGTTG Clark et al.63 N/A Upper strand, Reverse GTTGGATCCATTGCCATCCAGTTG Clark et al.63 N/A Recombinant DNA pENTR/D-Topo entry vector Invitrogen K240020 pBPGAL4.2::VP16Uw Addgene64 RRID: Addgene_26228 Software and algorithms Imaris https://imaris.oxinst.com/products/ imaris-for-core-facilities Imaris for Core Facilities; Oxford Instruments Article Title: A JUN N-terminal kinase inhibitor induces ectodomain shedding of the cancer-associated membrane protease Prss14/epithin via protein kinase CβII Article Snippet: Cells were observed with a Imaging:Article Title: Live imaging reveals hub cell assembly and compaction dynamics during morphogenesis of the Drosophila testis niche Article Snippet: Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: A threshold grey level for immunopositive cells was chosen that was approximately 50% of the maximum grey level cell signal over background. Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: Article Title: An actomyosin network organizes niche morphology and responds to feedback from recruited stem cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER His2Av::mRFP1 Bloomington Drosophila Stock Center Flybase: FBtp0056035; RRID: BDSC_23651; RRID: BDSC_23650 UAS-MyoII HC RNAi Bloomington Drosophia Stock Center RRID: BDSC_65947 UAS-MyoII RLC RNAi Bloomington Drosophia Stock Center RRID: BDSC_33892 UAS-Cdc25 RNAi Bloomington Drosophia Stock Center RRID: BDSC_34831 P(UAS-hid.Z)2 Bloomington Drosophia Stock Center RRID: BDSC_65403 P{w[BmC]=Dfd-EYFP.w[BmC]}2 Bloomington Drosophia Stock Center RRID: BDSC_8623 TM6B, P{Dfd-GMR-nvYFP}4, Sb[1] Tb[1] ca[1] Bloomington Drosophia Stock Center RRID: BDSC_23232 UAS-E-Cadherin RNAi (Shg RNAi) Bloomington Drosophila Stock Center RRID: BDSC_32904 Oligonucleotides Lower strand, Forward CACCCAGCAAAGACCGTGAGTTG Clark et al.63 N/A Upper strand, Reverse GTTGGATCCATTGCCATCCAGTTG Clark et al.63 N/A Recombinant DNA pENTR/D-Topo entry vector Invitrogen K240020 pBPGAL4.2::VP16Uw Addgene64 RRID: Addgene_26228 Software and algorithms Imaris https://imaris.oxinst.com/products/ imaris-for-core-facilities Imaris for Core Facilities; Oxford Instruments Article Title: A JUN N-terminal kinase inhibitor induces ectodomain shedding of the cancer-associated membrane protease Prss14/epithin via protein kinase CβII Article Snippet: Cells were observed with a Fluorescence:Article Title: Live imaging reveals hub cell assembly and compaction dynamics during morphogenesis of the Drosophila testis niche Article Snippet: Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: A threshold grey level for immunopositive cells was chosen that was approximately 50% of the maximum grey level cell signal over background. Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: Article Title: An actomyosin network organizes niche morphology and responds to feedback from recruited stem cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER His2Av::mRFP1 Bloomington Drosophila Stock Center Flybase: FBtp0056035; RRID: BDSC_23651; RRID: BDSC_23650 UAS-MyoII HC RNAi Bloomington Drosophia Stock Center RRID: BDSC_65947 UAS-MyoII RLC RNAi Bloomington Drosophia Stock Center RRID: BDSC_33892 UAS-Cdc25 RNAi Bloomington Drosophia Stock Center RRID: BDSC_34831 P(UAS-hid.Z)2 Bloomington Drosophia Stock Center RRID: BDSC_65403 P{w[BmC]=Dfd-EYFP.w[BmC]}2 Bloomington Drosophia Stock Center RRID: BDSC_8623 TM6B, P{Dfd-GMR-nvYFP}4, Sb[1] Tb[1] ca[1] Bloomington Drosophia Stock Center RRID: BDSC_23232 UAS-E-Cadherin RNAi (Shg RNAi) Bloomington Drosophila Stock Center RRID: BDSC_32904 Oligonucleotides Lower strand, Forward CACCCAGCAAAGACCGTGAGTTG Clark et al.63 N/A Upper strand, Reverse GTTGGATCCATTGCCATCCAGTTG Clark et al.63 N/A Recombinant DNA pENTR/D-Topo entry vector Invitrogen K240020 pBPGAL4.2::VP16Uw Addgene64 RRID: Addgene_26228 Software and algorithms Imaris https://imaris.oxinst.com/products/ imaris-for-core-facilities Imaris for Core Facilities; Oxford Instruments Article Title: A JUN N-terminal kinase inhibitor induces ectodomain shedding of the cancer-associated membrane protease Prss14/epithin via protein kinase CβII Article Snippet: Cells were observed with a Virus:Article Title: Live imaging reveals hub cell assembly and compaction dynamics during morphogenesis of the Drosophila testis niche Article Snippet: Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: A threshold grey level for immunopositive cells was chosen that was approximately 50% of the maximum grey level cell signal over background. Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: Article Title: An actomyosin network organizes niche morphology and responds to feedback from recruited stem cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER His2Av::mRFP1 Bloomington Drosophila Stock Center Flybase: FBtp0056035; RRID: BDSC_23651; RRID: BDSC_23650 UAS-MyoII HC RNAi Bloomington Drosophia Stock Center RRID: BDSC_65947 UAS-MyoII RLC RNAi Bloomington Drosophia Stock Center RRID: BDSC_33892 UAS-Cdc25 RNAi Bloomington Drosophia Stock Center RRID: BDSC_34831 P(UAS-hid.Z)2 Bloomington Drosophia Stock Center RRID: BDSC_65403 P{w[BmC]=Dfd-EYFP.w[BmC]}2 Bloomington Drosophia Stock Center RRID: BDSC_8623 TM6B, P{Dfd-GMR-nvYFP}4, Sb[1] Tb[1] ca[1] Bloomington Drosophia Stock Center RRID: BDSC_23232 UAS-E-Cadherin RNAi (Shg RNAi) Bloomington Drosophila Stock Center RRID: BDSC_32904 Oligonucleotides Lower strand, Forward CACCCAGCAAAGACCGTGAGTTG Clark et al.63 N/A Upper strand, Reverse GTTGGATCCATTGCCATCCAGTTG Clark et al.63 N/A Recombinant DNA pENTR/D-Topo entry vector Invitrogen K240020 pBPGAL4.2::VP16Uw Addgene64 RRID: Addgene_26228 Software and algorithms Imaris https://imaris.oxinst.com/products/ imaris-for-core-facilities Imaris for Core Facilities; Oxford Instruments Article Title: A JUN N-terminal kinase inhibitor induces ectodomain shedding of the cancer-associated membrane protease Prss14/epithin via protein kinase CβII Article Snippet: Cells were observed with a Electron Microscopy:Article Title: Live imaging reveals hub cell assembly and compaction dynamics during morphogenesis of the Drosophila testis niche Article Snippet: Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: A threshold grey level for immunopositive cells was chosen that was approximately 50% of the maximum grey level cell signal over background. Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: Article Title: An actomyosin network organizes niche morphology and responds to feedback from recruited stem cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER His2Av::mRFP1 Bloomington Drosophila Stock Center Flybase: FBtp0056035; RRID: BDSC_23651; RRID: BDSC_23650 UAS-MyoII HC RNAi Bloomington Drosophia Stock Center RRID: BDSC_65947 UAS-MyoII RLC RNAi Bloomington Drosophia Stock Center RRID: BDSC_33892 UAS-Cdc25 RNAi Bloomington Drosophia Stock Center RRID: BDSC_34831 P(UAS-hid.Z)2 Bloomington Drosophia Stock Center RRID: BDSC_65403 P{w[BmC]=Dfd-EYFP.w[BmC]}2 Bloomington Drosophia Stock Center RRID: BDSC_8623 TM6B, P{Dfd-GMR-nvYFP}4, Sb[1] Tb[1] ca[1] Bloomington Drosophia Stock Center RRID: BDSC_23232 UAS-E-Cadherin RNAi (Shg RNAi) Bloomington Drosophila Stock Center RRID: BDSC_32904 Oligonucleotides Lower strand, Forward CACCCAGCAAAGACCGTGAGTTG Clark et al.63 N/A Upper strand, Reverse GTTGGATCCATTGCCATCCAGTTG Clark et al.63 N/A Recombinant DNA pENTR/D-Topo entry vector Invitrogen K240020 pBPGAL4.2::VP16Uw Addgene64 RRID: Addgene_26228 Software and algorithms Imaris https://imaris.oxinst.com/products/ imaris-for-core-facilities Imaris for Core Facilities; Oxford Instruments Article Title: A JUN N-terminal kinase inhibitor induces ectodomain shedding of the cancer-associated membrane protease Prss14/epithin via protein kinase CβII Article Snippet: Cells were observed with a Immunofluorescence:Article Title: Live imaging reveals hub cell assembly and compaction dynamics during morphogenesis of the Drosophila testis niche Article Snippet: Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: A threshold grey level for immunopositive cells was chosen that was approximately 50% of the maximum grey level cell signal over background. Article Title: Tonic, but not phasic corticosterone constrains stress activated extracellular-regulated-kinase 1/2 immunoreactivity within the hypothalamic paraventricular nucleus Article Snippet: Article Title: An actomyosin network organizes niche morphology and responds to feedback from recruited stem cells. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER His2Av::mRFP1 Bloomington Drosophila Stock Center Flybase: FBtp0056035; RRID: BDSC_23651; RRID: BDSC_23650 UAS-MyoII HC RNAi Bloomington Drosophia Stock Center RRID: BDSC_65947 UAS-MyoII RLC RNAi Bloomington Drosophia Stock Center RRID: BDSC_33892 UAS-Cdc25 RNAi Bloomington Drosophia Stock Center RRID: BDSC_34831 P(UAS-hid.Z)2 Bloomington Drosophia Stock Center RRID: BDSC_65403 P{w[BmC]=Dfd-EYFP.w[BmC]}2 Bloomington Drosophia Stock Center RRID: BDSC_8623 TM6B, P{Dfd-GMR-nvYFP}4, Sb[1] Tb[1] ca[1] Bloomington Drosophia Stock Center RRID: BDSC_23232 UAS-E-Cadherin RNAi (Shg RNAi) Bloomington Drosophila Stock Center RRID: BDSC_32904 Oligonucleotides Lower strand, Forward CACCCAGCAAAGACCGTGAGTTG Clark et al.63 N/A Upper strand, Reverse GTTGGATCCATTGCCATCCAGTTG Clark et al.63 N/A Recombinant DNA pENTR/D-Topo entry vector Invitrogen K240020 pBPGAL4.2::VP16Uw Addgene64 RRID: Addgene_26228 Software and algorithms Imaris https://imaris.oxinst.com/products/ imaris-for-core-facilities Imaris for Core Facilities; Oxford Instruments Article Title: A JUN N-terminal kinase inhibitor induces ectodomain shedding of the cancer-associated membrane protease Prss14/epithin via protein kinase CβII Article Snippet: Cells were observed with a |